Hundreds Injured by COVID Vaccines Turn to GoFundMe for Help With Expenses

High school senior Emma Burkey received the one-shot Johnson & Johnson (J&J) COVID vaccine April 1. Within two weeks she was placed in an induced coma. She underwent three brain surgeries after experiencing seizures and developing blood clots in her brain.

When Burkey was well enough to be transferred from the hospital to a rehabilitation center, her first round of bills totaled $513,000.

Friends of the 18-year-old’s family turned to GoFundMe to raise money to help cover Burkey’s mounting medical costs. As of July 7, more than $59,000 had been raised.

The family hopes most of Burkey’s medical costs will be covered by insurance — but that’s unclear, as the cost of their daughter’s medical care could run into millions of dollars.

“Right now it feels like the national debt,” a family spokesperson said. “It’s so big you can’t get your head around it.”

According to a recent update on Burkey’s GoFundMe page, Burkey is still in intensive rehab, remains in a wheelchair and was able to stand unassisted for the first time July 6 — almost four months after she got the vaccine.

More than 180 people seeking help on GoFundMe

As The Defender reported July 1, research compiled by a group in Mesa County, Colorado, showed as of June 25 there were more than 180 GoFundMe accounts seeking help for people who had suffered injuries after receiving a COVID vaccine and were left with large medical bills and other expenses….

https://childrenshealthdefense.org/defender/hundreds-injured-covid-vaccines-gofundme-expenses/

Xenobiology and Infinite Gullibility

What a great idea!  Entrust the integrity of human genetics to the emotionally stunted survivors of  american obstetrics and pediatrics.   They can’t even be trusted to get the spike protein right.

… Nature uses 20 amino acids to create life – every living thing in the whole wide world uses combinations of these 20 amino acids to make proteins. DNA churns out code for proteins all the time. It does this by using a language that only has four letters: A, T, C, G. These letters stand for Adenine, Thymine, Cytosine, Guanine. A and T go together to make one base pair, and C and G go together to make another base pair.

RNA is a bit different because it uses uridine instead of thymine, so it uses A, U, C, G. (Thymine is also called methyluracil.)

Adenine, thymine, cytosine, guanine and uridine are nucleotides that incorporate phosphates and sugars to form a ‘backbone’. Combining these letters or nucleotides makes ‘words’, or codons, and each codon specifies a particular amino acid should be created. When the amino acids are combined together, they make a particular type of protein. All of this happens inside the cell.

  • 3 nucleotides = 1 codon
  • 1 codon = 1 amino acid
  • Examples: the three nucleotides AAG form a codon which spells out the amino acid Lysine, whilst AGG forms a codon which spells out the amino acid Arginine.
  • Most amino acids can be made using more than one codon. For example, Lysine can also be made with the codon AAA, whilst Arginine can be made with any of these six codons: AGG, CGT, CGC, CGA, CGG, AGA.
  • Even though there are hundreds of amino acids, every living thing on earth is made from the same set of 20 amino acids.
  • Antibodies are proteins!

Unfortunately, some bright spark worked out that the two base-pairs formed by DNA and RNA could be represented in computer code by using ones and zeros. This allows scientists to play around with genetic sequences more easily and even invent new versions using stuff that doesn’t occur naturally. There’s no end to what they can do with genetics so a huge amount of effort has been invested in building the industry in a ‘behind the scenes’ kind of way. The idea has been floated that mRNA could be used for ANYTHING, as if it could end up replacing modern medicine entirely despite the fact that most of the human genome is not understood! A whopping 85% of our DNA is dismissed as worthless junk, but new discoveries that prove this wrong are being made all the time.

How to play God with genetics

Strands of DNA and RNA are formed by stringing together long chains of molecules called nucleotides. A nucleotide is made up of three chemical components: one of the bases (either adenine, guanine, cytosine, thymine or uridine), a phosphate, and a five-carbon sugar group. It’s possible to tinker with all three of these components by using different chemicals; the mRNA vaccines are altering the base by changing the uridine to pseudouridine, and there’s a possibility that changes have been made to some of the phosphate and sugar components as well. Altering any of the three components that make up a nucleotide creates what is known as a nucleic acid analogue, and when the sugar component is swapped for a chemical that’s never used in nature, it’s usually referred to as XNA (xeno nucleic acid). According to Wikipedia:

Nucleic acid analogues are compounds which are analogous (structurally similar) to naturally occurring RNA and DNA, used in medicine and in molecular biology research. Nucleic acids are chains of nucleotides, which are composed of three parts: a phosphate backbone, a pentose sugar, either ribose or deoxyribose, and one of four nucleobases. An analogue may have any of these altered. …. Nucleic acid analogues are also called Xeno Nucleic Acid and represent one of the main pillars of xenobiology, the design of new-to-nature forms of life based on alternative biochemistries.”

Xeno Nucleic Acid (XNA) in the mRNA?

Xeno means ‘alien’ or ‘not of this world’ and xeno nucleic acids are classed as alien because they use chemicals that nature never uses. Several types of XNA have been invented so far[i], and these include:

  • Threose nucleic acid (TNA)
  • Glycol nucleic acid (GNA)
  • Locked nucleic acid (LNA) [ii]
  • Peptide nucleic acid (PNA)
  • Cyclohexene nucleic acid (CeNA)
  • 1,5-anhydrohexitol nucleic acid (HNA)
  • Fluoro Arabino nucleic acid (FANA)

Most (perhaps all) of Moderna’s patents refer to the possibility of using various types of XNA to make their products, in addition to using DNA and RNA. For example, the patent for Moderna’s Betacoronavirus mRNA vaccine was filed in February, 2020, and it describes the possibility of using: “threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs)[iii], ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or chimeras or combinations thereof.”

The motivation for using XNA is because it helps to stabilize mRNA, and because it protects it from RNases. All types of RNA are vulnerable to degradation because there are lots of RNase enzymes flying around all over the place. They’re literally everywhere – floating around in the air and coursing through our veins. This means precautions have to be taken to limit the effect of RNases during manufacturing; similarly, RNases in people’s bodies can totally destroy mRNA within minutes. Locked nucleic acid (LNA) does not activate RNase enzymes, so it would limit degradation of the mRNA. It’s said that locked nucleic acid (LNA) can be used to modify mRNA in order to stabilize it and get more of it get translated . Overall, LNA prolongs the half-life of mRNA which means more of it gets translated, and more proteins get made. LNA can also be used to stabilize the cap of mRNA, which is the very first bit of a mRNA sequence. (A cap made with LNA is available for sale here.) Another option is to incorporate some LNA nucleotides “at the ends of RNA and DNA sequences to form chimeric oligonucleotides…”

The EMA and the FDA have previously approved three types of non-natural nucleic acids for various diseases. These include Eteplirsen and Golodirsen which both have a morpholino phosphoramidate backbone, whilst others have a phosphorothioate and 2′ methoxyethyl backbone. The package insert for Golodirsen says every sugar has been replaced with a morpholino ring and every phosphate has been replaced with phosphorodiamidate, whilst the bases remain the same as normal. These modifications are a key feature of Golodirsen, whereas the most prominent modification of the mRNA in the coronavirus vaccine involves changing one of the bases. Instead of using uridine, the vaccines are using pseudouridine, as stated in all their documents. None of the documents refer to using LNA in the cap or anywhere else in the sequence, but it’s perhaps possible that there’s no requirement to report the use of LNA if it’s not a prominent feature. Golodirsen is a tiny construct compared to the mRNA in the vaccines, and a smidge of LNA in the cap might be shrugged off as a technicality.

The vaccines are heavily modified with pseudouridine

Instead of using uridine to make nucleotides, the Moderna and Pfizer vaccines both use N1mΨ, which is short-hand for the chemical formula ‘N1-methyl-pseudouridine’. Ψ is the symbol for pseudouridine which has different chemical properties to uridine so it affects the way the nucleotides function. Vaccine makers are saying it’s a natural thing because we sometimes make Ψ ourselves, but that doesn’t mean it’s normal for a virus to contain Ψ. What’s more, it’s not clear if humans ever make N1mΨ, which is a methylated version of Ψ, although it has been found now and then in the genetic sequence of some kinds of archaea.

The first part of the mRNA code for the spike protein of SARS-CoV-2 is:

GAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC

But the mRNA vaccines have changed all the uridines to the N1mΨ version of pseudouridine, which is written like this:

GAAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCCGCCACC

The two researchers who came up with this idea were Katalin Kariko and Drew Weissman from the University of Pennsylvania. They published a paper in 2005 describing how mRNA made with pseudo-U was more likely to work than normal mRNA. Most scientists had given up on using mRNA for gene therapy because the immune system was able to destroy it but pseudo-U could trick the immune system into ignoring the mRNA, meaning it was more likely to get translated.  A few years later, Kariko and Weissman made another discovery – using HPLC to remove bacterial residues from mRNA also helped it get translated. The production of mRNA involves using a bacterial plasmid, and this bacteria was contaminating the mRNA to such an extent that it triggered the immune system, which then destroyed the mRNA as well as the bacteria. Using HPLC to purify the mRNA made this less likely to happen, and in 2010, Moderna was founded and immediately began filing patents for mRNA made with pseudouridine. The pseudo-U technique was patented by the University of Pennsylvania and the patents were later assigned to the NIH. …

https://www.activistpost.com/2021/07/alien-vaccines-with-mutant-spikes.html

Great Reset: Technocrat Agenda To Steer Global Society Towards Massive Surveillance And Control

The WEF’s planned Great Reset is the main column of attack in the battle to implement Technocracy on a global scale. It is a return to frontal assault after four decades of “end run around national sovereignty.” Its plans for scientific dictatorship are laid bare by its own actors.Note that the author of this article calls it “a technocratic agenda that waited years for a global crisis to exploit” and a “vision of a technocratic Utopia.” Technocracy News & Trends has warned for several years that Technocracy is the clear and present danger and now it has stepped into the limelight. Few, however, realize that the threat is real and that it is deadly. If Technocracy’s coup d’état is successful, the concepts of freedom and liberty will be gone from the face of the earth. ⁃ TN Editor

In the face of a global pandemic, an un-elected body of global bureaucrats based in Davos, Switzerland has asked the world to trust its vision of a technocratic “great reset,” knowing full well the public would never go for such a request had it not been for the golden opportunity they’d all been waiting for.

When the head of the World Economic Forum (WEF), Klaus Schwab, announced in June that “Now is the time for a great reset,” it wasn’t the first time he called for it.

In fact, he called on the WEF to start the great reset over five years ago (see video below), but this year he’s saying that COVID-19 is the most urgent reason to restructure all of society and the global economy.

The great reset agenda was already in place long before the coronavirus pandemic, and the WEF was just waiting for a crisis to exploit it.

Prior to this year, implementing worldwide lockdowns that destroy businesses, wreck the economy, and leave people destitute and stripped of their constitutional rights while trying to enact invasive contact tracing, immunity passports, and otherwise massive bio-electronic surveillance apparatuses would never have been accepted by the citizens of a free society

The so-called great reset is an old ideology touted for decades by globalists like Henry Kissinger, who opined in 2014, “Never before has a new world order had to be assembled from so many different perceptions, or on so global a scale.”

The great reset is the proposed mechanism for setting in motion a new global order, but it wouldn’t be possible to bring forth such a bold plan without a global crisis, be it manufactured or of unfortunate happenstance, that shocks society to its core.

“The pandemic represents a rare but narrow window of opportunity to reflect, reimagine, and reset our world to create a healthier, more equitable, and more prosperous future” — Klaus Schwab, WEF

In this story, I will attempt to dissect:

  • What types of invasive surveillance technologies will be required by the great reset
  • Why the great reset is being re-branded and pushed in 2020
  • How the Davos crowd is trying to sell the great reset Utopia
  • Who will be asked to give up their privacy for the common good
  • When humans become hackable
  • Where you have the power to choose 

With the arrival of the coronavirus pandemic, the WEF has the perfect excuse to quickly enact its vision for steering society towards a more invasive and intrusive, technocratic future in the name of serving the common good.

The un-elected architects of the great reset envision a Utopian world of inclusivity, equality, and sustainability that will require trust in emerging technologies like AI, 5G, Blockchain, and robotics, in order to usher in their golden dawn.

Great Reset Will Require Trust in Invasive Surveillance Tech: WEF Promotes Health Passports & Contact Tracing

In order to bring about the great reset, it will require trust in the technology, and to be more specific, the WEF would like to have greater trust in “crisis-relevant tech,” which includes developing digital health passports and contact tracing, under a new form of internet governance.

“The Great Reset will require new institutions and business models, and new digital technologies to build them,” wrote the WEF Head of Corporate Governance and Trust, Daniel Dobrygowski, in a blog post. “The necessary collaboration, however, is only possible if we solve the digital trust problem,” he added.

According to the Dobrygowski, “The use of digital technology during the COVID-19 crisis offers clear lessons,” one of those being, “Target mistrust broadly to enable specific crisis-relevant tech.”

The WEF openly supports the development of so-called “crisis-relevant tech” as evidenced by its backing the development of health passports, which act as digital records of your health status to determine whether or not you are free to travel or even go outside.

Earlier this year the WEF announced it was supporting the development and launch of CommonPass — a platform whose mission is “to develop and launch a standard global model to enable people to securely document and present their COVID-19 status (either as test results or an eventual vaccination status) to facilitate international travel and border crossing while keeping their health information private.”

The WEF also lent its support to another health passport initiative called CovidPass, which was built by one of the WEF’s own “Young Global Leaders,” Mustapha Mokass, who used to be an advisor at the World Bank.

CovidPass “uses blockchain technology to store encrypted data from individual blood tests, allowing users to prove that they have tested negative for COVID-19.”

In supporting both CommonPass and CovidPass, the Davos elite have made it clear they want “crisis-relevant tech” like health passports to be part of the great reset solution.

Ask yourself, would the idea of being forced to electronically prove your current health status in order to travel or even leave your own home have been acceptable 10 months ago?

Why is this happening now?

The die was cast years ago, but only now do the Davos elite see a shrinking, yet golden opportunity, to create a new world order out of the coronavirus chaos.

COVID Presents a ‘Shrinking, Golden Opportunity’, Great Reset Is Not a Response to the Coronavirus

In June Prince Charles praised the great reset agenda for its potential to “make people more receptive to big visions of change” after having suffered through “unprecedented schockwaves.”

“We have a golden opportunity to seize something good from this crisis — its unprecedented shockwaves may well make people more receptive to big visions of change,” the prince told the WEF.

“Would the idea of being forced to electronically prove your current health status in order to travel or even leave your own home have been acceptable 10 months ago?”

Prince Charles may have let on more than he cared to share, or thought you would notice. Again, he’s telling you that the great reset was always the plan. COVID-19 is the excuse.

In other words, the coronavirus crisis presents a golden opportunity for the global establishment to further its agenda upon a frightful and angry population that has been so beaten down by the pandemic and subsequent lockdowns that they will have become more susceptible to giving over their freedoms to the idea of greater centralized power and control.

Prince Charles went on, “As we move from rescue to recovery, we have a unique but rapidly shrinking window of opportunity to learn lessons and reset ourselves on a more sustainable path. It is an opportunity we have never had before and may never have again.”

The British royal’s words echo those of WEF Director Schwab, who said, “The pandemic represents a rare but narrow window of opportunity to reflect, reimagine, and reset our world to create a healthier, more equitable, and more prosperous future.”

Again, why is the window of opportunity so narrow? Could the seeds of their grand strategy only flower while the world was distracted and divided amidst the chaos? ….

https://www.technocracy.news/great-reset-technocrat-agenda-to-steer-global-society-towards-massive-surveillance-and-control/

Rand Paul on govt disinformation re: natural immunity

Senator Rand Paul declared Thursday that he intends to introduce legislation that would scrap mask mandates, specifically on planes, calling the practice a ‘farce’.

Paul noted that he intends to seek a repeal of Joe Biden’s executive order mandating masks on public transit….

https://www.infowars.com/posts/rand-paul-says-he-will-introduce-bill-to-scrap-mask-mandate-farce/

WHO Deletes Naturally Acquired Immunity from Its Website

Capitol Police, Exempt From FOIA & Above The Law, Expanding Throughout U.S. Thanks to $2B in New Funding

The US Capitol Police are expanding their operations throughout the country thanks to $2 billion in new funding secured thanks to the self-professed “Defund the Police” champions of “the Squad.”

….

http://www.informationliberation.com/?id=62361

Obama the Cult Leader

Democratic Member Accuses Colleagues Of Conducting “Reconnaissance” For Capitol Rioters

FREE EMF Health Summit Features Leading Health Experts, Scientists and Authors to Discuss 5G, Wi-Fi, Utility “Smart” Meters, etc.

In 2019 The World Health Organization warned that exposure to high levels of Electromagnetic Fields (aka “Electrosmog”) could cause health issues in a significant percentage of the population.

Of course, warnings about “Electrosmog” and “Microwave Sickness” are decades old (see 1234).  People worldwide have been affected including American Embassy workers (see 123).

If you’re concerned about exposure, Lloyd Burrell, founder of ElectricSense, is hosting a free EMF Summit next week.


Are you concerned about 5G radiation and EMFs? Confused by the conflicting information out there?

Explore the latest science behind cell phone radiation, WiFi, smart meters and other EMF devices and their effects on your health with the world’s leading experts — find out what you can do to protect yourself and your loved ones!

The EMF Health Summit 2.0: Navigating EMFs, 5G, WiFi and Our Electromagnetic World is online and FREE from July 12-18, 2021.

Thousands of independent studies show that cell phones, WiFi and other common electronic devices that emit EMFs (electromagnetic fields) — like appliances and smart meters — are poisoning our environment, harming our children and contribute to a long list of serious illnesses.

In fact, the cell phone industry’s own research shows that cell phone radiation can cause cancer. Studies also suggest that children, the elderly and pregnant mothers are particularly vulnerable.

However, there are ways to mitigate the damage and protect your health and live WELL — despite the onslaught of electromagnetic pollution.

People commonly report improved sleep, more energy, deeper relaxation, clearer thinking and less anxiety when they eliminate or significantly reduce their EMF exposure. Additionally, reducing EMF toxicity can positively impact those in recovery from autoimmune diseases, cancer, genetic health challenges, brain conditions and unexplained chronic health issues….

https://www.activistpost.com/2021/07/free-emf-health-summit-features-leading-health-experts-scientists-and-authors-to-discuss-5g-wi-fi-utility-smart-meters-etc.html

Two South Florida Men Among Suspects Arrested In Assassination Of Haitian President

Late Thursday evening, a news conference was held at Haitian National Police Headquarters in the capital of Port-au-Prince with the country’s interim prime minister Claude Joseph and Mathias Pierre, a minister in charge of Haitian elections. The officials announced that two South Florida men and 15 Colombian nationals had been detained in the assassination of President Jovenel Moise, according to Miami Herald.

Two U.S. citizens of Haitian descent, James Solages, 35, of Fort Lauderdale and Joseph Vincent, 55, of Miami, were identified during the press conference.

Undated videos of Solages, whose primary residents is in Fort Lauderdale, described himself as a “philanthropist and child advocate who enjoyed helping schoolchildren from the area where he grew up,” according to Miami Herald. 

Haitian officials identified four of the other suspects arrested so far, all from Colombia: Alejandro Girardo Zapata, 41; John Jairo Ramirez Gomez, 40; Victor Albeiro Pinera Cardona, 40; and Manuel Antonio Groso Guarin, 41. The remaining suspects have yet to be named.

In total, 17 have been arrested, including the two Americans and 15 Colombians. There seems to be a discrepancy of initial reports that police killed seven assailants but now the figure is three. The police didn’t explain the difference.

Some of the assailants were rounded up by residents in the capital and handed over to police. We shared a video of this on Thursday afternoon.

Searches continue Friday for more suspects. Police said there could be eight more on the run.

“We are pursuing them. We are asking the public to help us,” said Haiti’s police chief, Leon Charles. 

The country’s interim prime minister said a group of foreigners had entered the country to kill the president “in a cowardly fashion.”

“They forgot something,” Joseph said. “You may kill the president, but you cannot kill his dreams, you cannot kill his ideology, and you cannot kill what he was fighting for. That’s why I’m determined for President Jovenel Moïse’s family, friends and allies, and the Haitian population, to get justice.”

At Haiti’s National Police Headquarters, authorities showed images on national television of the assailants. They also displayed the weapons used in the assassination, including assault rifles, shotguns, sledgehammers, machetes, and bolt cutters. …

https://www.zerohedge.com/markets/two-south-florida-men-among-suspects-arrested-assassination-haitian-president

Apparently the PM wasn’t on board with the agenda:

Haiti rejects COVID-19 vaccine from WHO

The Haitian government has declined to receive the AstraZeneca COVID-19 vaccine proposed by the World Health Organization (WHO), according to EFE, a Dominican news outlet.

About 756,000 vaccine doses were scheduled to arrive in Haiti in May, free of charge to the government, according to The Guardian.

Haïti has asked for vaccines from other drugmakers, an unnamed government source told EFE. However, the country’s lack of deep refrigeration infrastructure can only accommodate the AstraZeneca and Johnson & Johnson vaccines, which don’t require the deeply cold temperatures environments for handling and safekeeping. Source….

Biden Does Not Need A Domestic “Terrorism” Agenda Unless He Is About To Violate American Rights

The federal government is a kind of self perpetuating blob; a cannibalistic creature that must continue to feed on the public and the systems around it in order to survive, but it also must create reasons for its existence so that it may go on feeding uninterrupted. Now, don’t get me wrong – I realize that the apparatus in Washington DC is nothing more than a tool for the power elite to grow their scope of control as well as grow their wealth. That said, without a large federal government the establishment oligarchy would have no ability to project the force they need to compel the population to comply with their agenda.

There are only two real mandates for the government, only two reasons for its existence in our republic: To secure America’s borders from invasion and to protect the freedoms of the citizenry. That’s it. It is not the job of the government to compel you to take an experimental and questionable covid vaccine over a virus that 99.7% of people will easily survive. It is not the job of the government to create artificial “social equity” by favoring one group or ethnicity over another. It is not the job of the government to spy on millions of Americans because they do not agree with the leftist ideology. It is not the job of government to make war on the very people it is mandated to protect.

Yet, this is exactly what the government is doing today while its totalitarianism is disguised as “humanitarianism”. In other words, they are essentially arguing that they must make war on the people in order to protect the people from themselves.

One of Joe Biden’s first actions upon entering the White House was to initiate a 100 day review of the government’s domestic terrorism policies, and I think this says a lot about what path his presidency is bound to follow. Yes, the media continually argues that the Capitol protest on Jan 6th was a vast conspiracy on the part of conservatives to “overthrow” the democratic process and commit insurrection. In fact, all it really amounted to was a large protest which was less violent than the majority of Black Lives Matter protests across the nation over the past year.

The media also incessantly mentions the five deaths that occurred on the day of the protest while continuing to ignore the fact that NOT ONE of those deaths has been attributed to the direct actions of protesters, and at least three of the deaths were due to natural causes.

Why does the mainstream media keep lying by omission? Because they have to keep the narrative alive that the capitol protest is a sign of some underlying conservative “evil” that must be contained or destroyed. We don’t really give them much to work with, so they have to create reasons out of thin air to convince people to hate us.

Biden’s review of domestic terrorist policy was finally released last month and the propaganda has been building ever since.  It has now culminated in Big Tech conglomerates like Facebook calling for people to report family and friends that might be exhibiting “signs of extremism”.  This is the Soviet Cheka or the East German Stasi all over again.

Two of the administration’s primary findings in their report included the assertion that domestic threats are “motivated by racism and white supremacy”, and that they are driven by anti-authority. For many this might sound like bizarro world.

What the hell does racism have to do with the capitol protests or anything else that conservatives have been fighting for the past year? Biden is a white guy, after all, so protesting his entry into the White House is hardly race motivated. And, if you ask the majority of patriots why they are angry you will find that most of them have grown tired of the pandemic restrictions and medical tyranny, which they know will only continue to get worse under Biden. Is this viewpoint “anti-authority”, or just anti-authoritarianism?

Keep in mind that these days almost anything can be labeled racist or extremist.  The interpretation is wide open and arbitrary.  This is how informant culture works.  Anyone can be a target for any reason and one is treated as guilty until proven innocent.

Obviously Biden and his handlers are not concerned with what is ACTUALLY causing Americans to rebel by the millions. They already know that THEY are the real cause, along with their attempts to undermine American civil liberties. What this is really about is gaslighting….

https://alt-market.us/biden-does-not-need-a-domestic-terrorism-agenda-unless-he-is-about-to-violate-american-rights/