Xenobiology and Infinite Gullibility

What a great idea!  Entrust the integrity of human genetics to the emotionally stunted survivors of  american obstetrics and pediatrics.   They can’t even be trusted to get the spike protein right.

… Nature uses 20 amino acids to create life – every living thing in the whole wide world uses combinations of these 20 amino acids to make proteins. DNA churns out code for proteins all the time. It does this by using a language that only has four letters: A, T, C, G. These letters stand for Adenine, Thymine, Cytosine, Guanine. A and T go together to make one base pair, and C and G go together to make another base pair.

RNA is a bit different because it uses uridine instead of thymine, so it uses A, U, C, G. (Thymine is also called methyluracil.)

Adenine, thymine, cytosine, guanine and uridine are nucleotides that incorporate phosphates and sugars to form a ‘backbone’. Combining these letters or nucleotides makes ‘words’, or codons, and each codon specifies a particular amino acid should be created. When the amino acids are combined together, they make a particular type of protein. All of this happens inside the cell.

  • 3 nucleotides = 1 codon
  • 1 codon = 1 amino acid
  • Examples: the three nucleotides AAG form a codon which spells out the amino acid Lysine, whilst AGG forms a codon which spells out the amino acid Arginine.
  • Most amino acids can be made using more than one codon. For example, Lysine can also be made with the codon AAA, whilst Arginine can be made with any of these six codons: AGG, CGT, CGC, CGA, CGG, AGA.
  • Even though there are hundreds of amino acids, every living thing on earth is made from the same set of 20 amino acids.
  • Antibodies are proteins!

Unfortunately, some bright spark worked out that the two base-pairs formed by DNA and RNA could be represented in computer code by using ones and zeros. This allows scientists to play around with genetic sequences more easily and even invent new versions using stuff that doesn’t occur naturally. There’s no end to what they can do with genetics so a huge amount of effort has been invested in building the industry in a ‘behind the scenes’ kind of way. The idea has been floated that mRNA could be used for ANYTHING, as if it could end up replacing modern medicine entirely despite the fact that most of the human genome is not understood! A whopping 85% of our DNA is dismissed as worthless junk, but new discoveries that prove this wrong are being made all the time.

How to play God with genetics

Strands of DNA and RNA are formed by stringing together long chains of molecules called nucleotides. A nucleotide is made up of three chemical components: one of the bases (either adenine, guanine, cytosine, thymine or uridine), a phosphate, and a five-carbon sugar group. It’s possible to tinker with all three of these components by using different chemicals; the mRNA vaccines are altering the base by changing the uridine to pseudouridine, and there’s a possibility that changes have been made to some of the phosphate and sugar components as well. Altering any of the three components that make up a nucleotide creates what is known as a nucleic acid analogue, and when the sugar component is swapped for a chemical that’s never used in nature, it’s usually referred to as XNA (xeno nucleic acid). According to Wikipedia:

Nucleic acid analogues are compounds which are analogous (structurally similar) to naturally occurring RNA and DNA, used in medicine and in molecular biology research. Nucleic acids are chains of nucleotides, which are composed of three parts: a phosphate backbone, a pentose sugar, either ribose or deoxyribose, and one of four nucleobases. An analogue may have any of these altered. …. Nucleic acid analogues are also called Xeno Nucleic Acid and represent one of the main pillars of xenobiology, the design of new-to-nature forms of life based on alternative biochemistries.”

Xeno Nucleic Acid (XNA) in the mRNA?

Xeno means ‘alien’ or ‘not of this world’ and xeno nucleic acids are classed as alien because they use chemicals that nature never uses. Several types of XNA have been invented so far[i], and these include:

  • Threose nucleic acid (TNA)
  • Glycol nucleic acid (GNA)
  • Locked nucleic acid (LNA) [ii]
  • Peptide nucleic acid (PNA)
  • Cyclohexene nucleic acid (CeNA)
  • 1,5-anhydrohexitol nucleic acid (HNA)
  • Fluoro Arabino nucleic acid (FANA)

Most (perhaps all) of Moderna’s patents refer to the possibility of using various types of XNA to make their products, in addition to using DNA and RNA. For example, the patent for Moderna’s Betacoronavirus mRNA vaccine was filed in February, 2020, and it describes the possibility of using: “threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs)[iii], ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or chimeras or combinations thereof.”

The motivation for using XNA is because it helps to stabilize mRNA, and because it protects it from RNases. All types of RNA are vulnerable to degradation because there are lots of RNase enzymes flying around all over the place. They’re literally everywhere – floating around in the air and coursing through our veins. This means precautions have to be taken to limit the effect of RNases during manufacturing; similarly, RNases in people’s bodies can totally destroy mRNA within minutes. Locked nucleic acid (LNA) does not activate RNase enzymes, so it would limit degradation of the mRNA. It’s said that locked nucleic acid (LNA) can be used to modify mRNA in order to stabilize it and get more of it get translated . Overall, LNA prolongs the half-life of mRNA which means more of it gets translated, and more proteins get made. LNA can also be used to stabilize the cap of mRNA, which is the very first bit of a mRNA sequence. (A cap made with LNA is available for sale here.) Another option is to incorporate some LNA nucleotides “at the ends of RNA and DNA sequences to form chimeric oligonucleotides…”

The EMA and the FDA have previously approved three types of non-natural nucleic acids for various diseases. These include Eteplirsen and Golodirsen which both have a morpholino phosphoramidate backbone, whilst others have a phosphorothioate and 2′ methoxyethyl backbone. The package insert for Golodirsen says every sugar has been replaced with a morpholino ring and every phosphate has been replaced with phosphorodiamidate, whilst the bases remain the same as normal. These modifications are a key feature of Golodirsen, whereas the most prominent modification of the mRNA in the coronavirus vaccine involves changing one of the bases. Instead of using uridine, the vaccines are using pseudouridine, as stated in all their documents. None of the documents refer to using LNA in the cap or anywhere else in the sequence, but it’s perhaps possible that there’s no requirement to report the use of LNA if it’s not a prominent feature. Golodirsen is a tiny construct compared to the mRNA in the vaccines, and a smidge of LNA in the cap might be shrugged off as a technicality.

The vaccines are heavily modified with pseudouridine

Instead of using uridine to make nucleotides, the Moderna and Pfizer vaccines both use N1mΨ, which is short-hand for the chemical formula ‘N1-methyl-pseudouridine’. Ψ is the symbol for pseudouridine which has different chemical properties to uridine so it affects the way the nucleotides function. Vaccine makers are saying it’s a natural thing because we sometimes make Ψ ourselves, but that doesn’t mean it’s normal for a virus to contain Ψ. What’s more, it’s not clear if humans ever make N1mΨ, which is a methylated version of Ψ, although it has been found now and then in the genetic sequence of some kinds of archaea.

The first part of the mRNA code for the spike protein of SARS-CoV-2 is:

GAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC

But the mRNA vaccines have changed all the uridines to the N1mΨ version of pseudouridine, which is written like this:

GAAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCCGCCACC

The two researchers who came up with this idea were Katalin Kariko and Drew Weissman from the University of Pennsylvania. They published a paper in 2005 describing how mRNA made with pseudo-U was more likely to work than normal mRNA. Most scientists had given up on using mRNA for gene therapy because the immune system was able to destroy it but pseudo-U could trick the immune system into ignoring the mRNA, meaning it was more likely to get translated.  A few years later, Kariko and Weissman made another discovery – using HPLC to remove bacterial residues from mRNA also helped it get translated. The production of mRNA involves using a bacterial plasmid, and this bacteria was contaminating the mRNA to such an extent that it triggered the immune system, which then destroyed the mRNA as well as the bacteria. Using HPLC to purify the mRNA made this less likely to happen, and in 2010, Moderna was founded and immediately began filing patents for mRNA made with pseudouridine. The pseudo-U technique was patented by the University of Pennsylvania and the patents were later assigned to the NIH. …

https://www.activistpost.com/2021/07/alien-vaccines-with-mutant-spikes.html

Leave a Reply

This site uses Akismet to reduce spam. Learn how your comment data is processed.